Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659100

gRNA Name: mtnr1a gRNA2
Synonyms: Xtmtnr1a T2, T2
Genomic Target: mtnr1a

Sequence: 5' GGACTGAGAGGATAACCAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20
genomic

gRNA
5' CCTGGTTATCCTCTCAGTCT 3' ||||||||||||||||||| 3' GGACCAATAGGAGAGTCAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:62519865..62519884 19/20 Sense off-target LOC108701348
chr1L:31745147..31745166 16/20 Antisense off-target LOC108698364
chr9_10S:57342319..57342338 19/20 unknown
tropicalis 10.0 Chr1:43686131..43686150 19/20 Antisense target mtnr1a
Chr2:173765815..173765834 18/20 Antisense off-target arhgef17
Chr3:140653442..140653461 16/20 Sense off-target cacna1a
Chr3:42112796..42112815 19/20 unknown
Chr9:71162731..71162750 19/20 unknown
Chr4:32684802..32684821 18/20 unknown
Chr3:129152783..129152802 17/20 unknown
Chr3:129208818..129208837 17/20 unknown
Publications
First: CRISPR/Cas9 mediated mutation of the mtnr1a melatonin receptor gene causes rod photoreceptor degeneration in developing Xenopus tropicalis., Sci Rep 2020                                    
Most recent:
View All Papers