Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659108

gRNA Name: adam12 gRNA1
Synonyms:
Genomic Target: adam12

PAM Sequence: GGG
Sequence: 5' GAGAGTGGTGAAAGGATCTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' AAGATCCTTTCACCACTCTC 3' |||||||||||||||||||| 3' TTCTAGGAAAGTGGTGAGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold67:306155..306174 18/20 Antisense off-target macf1.S
chr2L:88375807..88375826 18/20 Antisense off-target LOC108708274 [provisional:macf1]
chr9_10S:87564777..87564796 17/20 Sense off-target adap1.S
chr1S:50872046..50872065 18/20 unknown
chr9_10S:97243629..97243648 17/20 unknown
tropicalis 10.0 Chr7:24811980..24811999 20/20 Antisense target adam12
Chr1:127480452..127480471 17/20 Sense off-target glis3
Chr4:137015748..137015767 17/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers