Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659109

gRNA Name: hmmr gRNA1
Synonyms:
Genomic Target: hmmr

PAM Sequence: CGG
Sequence: 5' AGAGGTAGCCTTGAAGGTTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' AAACCTTCAAGGCTACCTCT 3' |||||||||||||||||||| 3' TTTGGAAGTTCCGATGGAGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr3:25077736..25077755 20/20 Antisense target hmmr
Chr10:45553124..45553143 18/20 Sense off-target mfsd11
Chr3:144681757..144681776 18/20 Sense off-target gucy2d
Chr4:79768123..79768142 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers