Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659111

gRNA Name: fap gRNA1
Synonyms:
Genomic Target: fap

PAM Sequence: GGG
Sequence: 5' CGTGGCTCCAGTCTCCAATT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' AATTGGAGACTGGAGCCACG 3' |||||||||||||||||||| 3' TTAACCTCTGACCTCGGTGC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:46440775..46440794 18/20 Antisense off-target med14.S
chr6S:104039744..104039763 18/20 Sense off-target LOC108695382 [provisional:runx1t1]
chr8L:48872535..48872554 18/20 Sense off-target mcf2.L
chr1S:126063056..126063075 17/20 Antisense off-target ggt5.S
chr4L:4012267..4012286 17/20 Antisense off-target galnt18.L
chr6L:110460492..110460511 17/20 Antisense off-target LOC108719227 [provisional:kctd1]
chr5L:12806091..12806110 16/20 Antisense off-target ush2a.L
chr8L:82356143..82356162 16/20 Sense off-target tyro3.L
chr6S:87419795..87419814 17/20 unknown
tropicalis 10.0 Chr9:71994758..71994777 20/20 Sense target fap
Chr6:15912933..15912952 18/20 Sense off-target dpp6
Chr6:15913371..15913390 18/20 Sense off-target dpp6
Chr6:110478688..110478707 18/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers