Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659113

gRNA Name: nuak1 gRNA1
Synonyms:
Genomic Target: nuak1

PAM Sequence: GGG
Sequence: 5' GAGACGAAGACTGAGTGAAA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 19/20
genomic

gRNA
5' TTTCACTCAGTCTTCGTCTC 3' |||||||||||||||||||| 3' AAAGTGAGTCAGAAGCAGAG 5' 5' TTTCACTCAGTCTTCGTCTC 3' |||||||||||||||||||| 3' AAAGTGAGTCAGAAGCAGAG 5' 5' TTTCGCTCAGTCTTCGTCTC 3' |||| ||||||||||||||| 3' AAAGTGAGTCAGAAGCAGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:44430076..44430095 20/20 Sense target nuak1.L
chr3S:93815954..93815973 19/20 Sense target nuak1.S
chr9_10L:104255752..104255771 17/20 Antisense off-target ankfn1l.L
tropicalis 10.0 Chr3:51686283..51686302 20/20 Sense target nuak1
Chr7:20659672..20659691 17/20 Sense off-target inpp5a.1
Chr9:88790358..88790377 16/20 Antisense off-target sema5b
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers