Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659114

gRNA Name: mdk gRNA1
Synonyms:
Genomic Target: mdk

PAM Sequence: GGG
Sequence: 5' AGACTGCGGAGCAGGAACTC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genomic

gRNA
5' GAGTTCCTGCTCCGCAGTCT 3' |||||||||||||||||||| 3' CTCAAGGACGAGGCGTCAGA 5' 5' GAGTTCCGGCTCCGCAGTCT 3' ||||||| |||||||||||| 3' CTCAAGGACGAGGCGTCAGA 5' 5' GAGTTCCAGCTCCGCAGTCT 3' ||||||| |||||||||||| 3' CTCAAGGACGAGGCGTCAGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:9051489..9051508 19/20 Sense target mdk.L
chr4S:13930813..13930832 19/20 Sense target mdk.S
chr6S:27681024..27681043 17/20 Sense off-target thsd7a.S
chr4S:24619203..24619222 16/20 unknown
tropicalis 10.0 Chr4:13271655..13271674 20/20 Sense target mdk
Chr5:112474663..112474682 17/20 Sense off-target mecom
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers