Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659115

gRNA Name: ezh2 gRNA1
Synonyms: ezh2_g1
Genomic Target: ezh2

Sequence: 5' GACCGGTGTGTTGGCGTAAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CTTACGCCAACACACCGGTC 3' |||||||||||||||||||| 3' GAATGCGGTTGTGTGGCCAG 5' 5' CTTCCGCCAACACACCGGTC 3' ||| |||||||||||||||| 3' GAATGCGGTTGTGTGGCCAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:52983208..52983227 19/20 Sense target ezh2.L
chr8S:84201403..84201422 18/20 Sense off-target lrfn1.1.S
chr6L:14518704..14518723 17/20 Antisense off-target ptprn2.L
chr6L:14518704..14518723 17/20 Antisense off-target LOC108718468 [provisional:ptprn2]
chr2L:53534154..53534173 16/20 Antisense off-target trim33.L
tropicalis 10.0 Chr6:55142695..55142714 20/20 Sense target ezh2
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers