Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659116

gRNA Name: ezh2 gRNA2
Synonyms: ezh2_g2
Genomic Target: ezh2

PAM Sequence: TGG
Sequence: 5' AGCAGTTTGGATTCACAGAA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 19/20
genomic

gRNA
5' TTCTGTGAATCCAAACTGCT 3' |||||||||||||||||||| 3' AAGACACTTAGGTTTGACGA 5' 5' TTCTGTGAATCCAAACTGCT 3' |||||||||||||||||||| 3' AAGACACTTAGGTTTGACGA 5' 5' TTCTCTGAATCCAAACTGCT 3' |||| ||||||||||||||| 3' AAGACACTTAGGTTTGACGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:53018990..53019009 20/20 Antisense target ezh2.L
chr6S:46067013..46067032 19/20 Antisense target ezh2.S
chr7S:70282735..70282754 19/20 Antisense off-target megf6.S
chr1S:175574824..175574843 18/20 Sense off-target setbp1.S
chr5S:112472865..112472884 18/20 Antisense off-target dzip1l.S
chr3L:56184300..56184319 17/20 Sense off-target zcrb1.L
chr4S:61747433..61747452 17/20 Antisense off-target dab1.S
chr9_10L:27743368..27743387 17/20 Antisense off-target LOC108701017
chr1L:10088755..10088774 16/20 Antisense off-target reep1.L
chr1L:2811794..2811813 16/20 Antisense off-target adra1d.L
chr5S:41138595..41138614 16/20 Antisense off-target strn.S
chr7L:108849139..108849158 18/20 unknown
chr2S:75240567..75240586 17/20 unknown
chr2S:125133157..125133176 16/20 unknown
chr3L:87026278..87026297 16/20 unknown
tropicalis 10.0 Chr6:55170690..55170709 20/20 Antisense target ezh2
Chr2:20352280..20352299 18/20 Antisense off-target tmprss15
Chr3:107953805..107953824 18/20 Sense off-target fes
Chr3:80054768..80054787 18/20 Sense off-target sema3e
Chr3:80054768..80054787 18/20 Antisense off-target LOC108646168
Chr9:19979482..19979501 18/20 Antisense off-target arhgap17
Chr5:105731625..105731644 16/20 Sense off-target mcf2l.2
Chr4:61559410..61559429 18/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers