Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659117

gRNA Name: suz12 gRNA1
Synonyms:
Genomic Target: suz12

PAM Sequence: CGG
Sequence: 5' GAGGGAGAGACTCGGAGTTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genomic

gRNA
5' CAACTCCGAGTCTCTCCCTC 3' |||||||||||||||||||| 3' GTTGAGGCTCAGAGAGGGAG 5' 5' CAACTCTGAGTCTCTCCCTC 3' |||||| ||||||||||||| 3' GTTGAGGCTCAGAGAGGGAG 5' 5' CAACTCAGAGTCTCTCCCTC 3' |||||| ||||||||||||| 3' GTTGAGGCTCAGAGAGGGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:44342646..44342665 19/20 Antisense target suz12.L
chr9_10S:40370375..40370394 19/20 Antisense target suz12.S
chr7L:117484620..117484639 18/20 unknown
tropicalis 10.0 Chr10:52001473..52001492 20/20 Antisense target suz12
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers