Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659118

gRNA Name: parm1 gRNA1
Synonyms:
Genomic Target: parm1

PAM Sequence: GGG
Sequence: 5' GAACAAGATTATGGCTCCTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' AAGGAGCCATAATCTTGTTC 3' |||||||||||||||||||| 3' TTCCTCGGTATTAGAACAAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:74018314..74018333 19/20 Sense off-target LOC108711048 [provisional:parm1]
chr1S:68288809..68288828 19/20 Sense off-target LOC108706763 [provisional:parm1]
chr6S:33466828..33466847 18/20 Antisense off-target skap2.S
chr1L:212233484..212233503 17/20 Sense off-target setbp1.L
chr6L:125114012..125114031 17/20 Antisense off-target ralyl.L
chr2S:40798223..40798242 16/20 Antisense off-target plxna2.S
chr9_10S:33370760..33370779 16/20 Sense off-target mrps7.S
chr9_10S:33370760..33370779 16/20 Sense off-target ftmt.S
chr9_10S:33370760..33370779 16/20 Antisense off-target mif4gd.S
chr6S:120037745..120037764 18/20 unknown
chr1S:85933549..85933568 17/20 unknown
chr3S:90009159..90009178 17/20 unknown
chr9_10L:20565800..20565819 17/20 unknown
chr5S:101672181..101672200 16/20 unknown
tropicalis 10.0 Chr1:79605352..79605371 20/20 Sense target parm1
Chr3:90725012..90725031 16/20 Sense off-target pcasp3
Chr1:115454217..115454236 18/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers