Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659119

gRNA Name: rspo2 gRNA1
Synonyms:
Genomic Target: rspo2

PAM Sequence: GGG
Sequence: 5' TGACTCCATAGTATCCAGGA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' TCCTGGATACTATGGAGTCA 3' |||||||||||||||||||| 3' AGGACCTATGATACCTCAGT 5' 5' TCCGGGATACTATGGAGTCA 3' ||| |||||||||||||||| 3' AGGACCTATGATACCTCAGT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:135149223..135149242 19/20 Antisense target rspo2.L
chr8L:22063569..22063588 17/20 Sense off-target nlgn3.L
chr8L:37566726..37566745 17/20 Antisense off-target LOC108698434 [provisional:il1rapl2]
chr9_10S:69646591..69646610 17/20 Sense off-target map2.S
chr1L:138612907..138612926 16/20 Sense off-target cdh24.L
chr2L:120082029..120082048 16/20 Antisense off-target clybl.L
chr5L:117232324..117232343 16/20 Sense off-target trpc1.L
chr5L:34997470..34997489 16/20 Sense off-target LOC108716606 [provisional:prkcd]
chr8L:14961081..14961100 16/20 Sense off-target XB5960368.L [provisional:eva1c]
chr5S:3031592..3031611 17/20 unknown
chr1L:20474423..20474442 16/20 unknown
chr4L:106175741..106175760 16/20 unknown
chr7S:47270229..47270248 16/20 unknown
tropicalis 10.0 Chr6:133578278..133578297 20/20 Antisense target rspo2
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers