Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659120

gRNA Name: tpcn1 gRNA1
Synonyms: tpcn_g1
Genomic Target: tpcn1

PAM Sequence: AGG
Sequence: 5' AGAGATGGAGGTGGGGAAAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CTTTCCCCACCTCCATCTCT 3' |||||||||||||||||||| 3' GAAAGGGGTGGAGGTAGAGA 5' 5' CCTTCCCCACCTCCATCTCT 3' | |||||||||||||||||| 3' GAAAGGGGTGGAGGTAGAGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:144209858..144209877 19/20 Sense target tpcn1.L
chr1L:13705779..13705798 18/20 Antisense off-target zfyve28-like.1.L
chr1L:89863850..89863869 18/20 Sense off-target chaf1a.L
chr2S:108534470..108534489 18/20 Antisense off-target lmo7.S
chr4L:17775275..17775294 18/20 Antisense off-target ptdss2.L
chr9_10L:142750..142769 18/20 Antisense off-target LOC108700739 [provisional:c20orf96]
chr2L:27402058..27402077 17/20 Sense off-target cmss1.L
chr2L:27402058..27402077 17/20 Antisense off-target LOC108707914 [provisional:filip1l]
chr5L:57289351..57289370 17/20 Sense off-target tbce.L
chr5L:8544181..8544200 17/20 Sense off-target haao.L
chr9_10L:6108340..6108359 17/20 Sense off-target mapt.L
chr9_10S:170113..170132 17/20 Sense off-target abca5.S
chr3S:49402371..49402390 16/20 Sense off-target LOC108712913
chr5S:1425650..1425669 16/20 Antisense off-target otx1.S
chr3L:109563230..109563249 20/20 unknown
chr4S:14308526..14308545 18/20 unknown
chr7S:78330306..78330325 18/20 unknown
chr8L:26309471..26309490 18/20 unknown
chr2S:116780130..116780149 17/20 unknown
tropicalis 10.0 Chr1:145311785..145311804 20/20 Sense target tpcn1
Chr1:210464559..210464578 18/20 Antisense off-target celf4
Chr6:115358838..115358857 18/20 Antisense off-target rp1
Chr7:128506976..128506995 17/20 Antisense off-target LOC101735205
Chr7:128510101..128510120 17/20 Antisense off-target LOC101735205
Chr7:128505711..128505730 16/20 Antisense off-target LOC101735205
Chr10:20530199..20530218 16/20 unknown
Chr4:144139384..144139403 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers