Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659121

gRNA Name: tpcn1 gRNA2
Synonyms: tpcn_g2
Genomic Target: tpcn1

PAM Sequence: AGG
Sequence: 5' GGGGATCACATTAGAGATGGAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 22/23 22/23
genomic

gRNA
5' CCTCCATCTCTAAGGTGATCCCC 3' ||||||||||||| ||||||||| 3' GGAGGTAGAGATTACACTAGGGG 5' 5' CCTCCATCTCTAAGGTGATCCCC 3' ||||||||||||| ||||||||| 3' GGAGGTAGAGATTACACTAGGGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:144209846..144209868 22/23 Sense target tpcn1.L
chr6L:38433411..38433433 20/23 Antisense off-target osbpl3.L
chr4L:115017476..115017498 19/23 Antisense off-target LOC108714544 [provisional:baiap2l2]
chr6L:148693357..148693379 19/23 Antisense off-target trappc9.L
chr8S:78373882..78373904 19/23 Sense off-target col11a2p1.S
chr9_10S:87532334..87532356 19/23 Sense off-target adap1.S
chr9_10L:42750797..42750819 19/23 unknown
tropicalis 10.0 Chr1:145311773..145311795 22/23 Sense target tpcn1
Chr4:121428117..121428139 19/23 Antisense off-target cacna1i
Chr8:105216070..105216092 19/23 Sense off-target tyro3
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers