Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659122

gRNA Name: abca4 gRNA1
Synonyms: abca4_g1
Genomic Target: abca4

Sequence: 5' GAGGAAACTCTTGGGGACTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' AAGTCCCCAAGAGTTTCCTC 3' |||||||||||||||||||| 3' TTCAGGGGTTCTCAAAGGAG 5' 5' AGGTCCCCAAGAGTTTCCTC 3' | |||||||||||||||||| 3' TTCAGGGGTTCTCAAAGGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:94457719..94457738 19/20 Sense target abca4.L
chr3L:5480281..5480300 18/20 Antisense off-target fkbp4.L
chr5L:58661756..58661775 18/20 Antisense off-target tarbp1.L
chr8L:72584078..72584097 18/20 Sense off-target nin.L
chr8S:79927532..79927551 18/20 Antisense off-target ppp1r10.S
chr5L:159129630..159129649 17/20 Antisense off-target srpk2l.L
chr1S:169765942..169765961 16/20 Antisense off-target malt1.S
chr2L:102671582..102671601 18/20 unknown
chr3S:43129128..43129147 17/20 unknown
tropicalis 10.0 Chr4:103734204..103734223 20/20 Sense target abca4
Chr6:37248587..37248606 18/20 Antisense off-target sostdc1
Chr9:5839383..5839402 18/20 Sense off-target hsd3b7
Chr9:33553997..33554016 16/20 unknown
Chr9:33555083..33555102 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers