Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659124

gRNA Name: abca4 gRNA3
Synonyms: abca4_g3
Genomic Target: abca4

Sequence: 5' GCAGTGGATAGACTCTGCGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 18/20
genomic

gRNA
5' ACGCAGAGTCTATCCACTGC 3' |||||||||||||||||||| 3' TGCGTCTCAGATAGGTGACG 5' 5' AGACAGAGTCTATCCACTGC 3' | ||||||||||||||||| 3' TGCGTCTCAGATAGGTGACG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:94479199..94479218 18/20 Sense target abca4.L
chr1S:44376022..44376041 19/20 unknown
tropicalis 10.0 Chr4:103765499..103765518 20/20 Sense target abca4
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers