Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659125

gRNA Name: ush2a gRNA2
Synonyms: ush2a_g1
Genomic Target: ush2a

Sequence: 5' GAGAGTCCAGTTCAGATAGA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' TCTATCTGAACTGGACTCTC 3' |||||||||||||||||||| 3' AGATAGACTTGACCTGAGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr7L:44442435..44442454 18/20 Antisense off-target grid1.L
chr1L:195790925..195790944 16/20 Sense off-target XB5962685.L [provisional:gzma]
chr4L:26634467..26634486 16/20 Antisense off-target cskmt.L
chr9_10S:99568727..99568746 19/20 unknown
chr4L:111297861..111297880 18/20 unknown
chr3S:109504577..109504596 17/20 unknown
chr1S:129035743..129035762 16/20 unknown
chr3S:120342188..120342207 16/20 unknown
tropicalis 10.0 Chr5:12795670..12795689 20/20 Antisense target ush2a
Chr1:91291516..91291535 17/20 Sense off-target kdm4b
Chr5:87158733..87158752 17/20 Sense off-target htr1e
Chr4:130178653..130178672 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers