Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659126

gRNA Name: kdm6a gRNA1
Synonyms:
Genomic Target: kdm6a

PAM Sequence: AGG
Sequence: 5' GGTAAAGGTGGATAGGGTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CCACCCTATCCACCTTTACC 3' |||||||||||||||||||| 3' GGTGGGATAGGTGGAAATGG 5' 5' CCACCTTATCCACCTTTACC 3' ||||| |||||||||||||| 3' GGTGGGATAGGTGGAAATGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:45003423..45003442 19/20 Antisense target kdm6a.S
chr2L:77843198..77843217 20/20 Antisense off-target LOC108708200 [provisional:kdm6a]
chr1S:115710217..115710236 18/20 Sense off-target cdh24.S
chr7L:36323298..36323317 18/20 Antisense off-target ascc1.L
chr3S:112203984..112204003 17/20 Antisense off-target LOC108712410 [provisional:slit3]
chr9_10L:19817416..19817435 17/20 Antisense off-target notum.L
chr8L:110983704..110983723 16/20 Antisense off-target LOC108699404
Scaffold85:418816..418835 17/20 unknown
Scaffold95:10062..10081 16/20 unknown
chr1S:78000569..78000588 16/20 unknown
chr2L:175909109..175909128 16/20 unknown
chr2S:49638690..49638709 16/20 unknown
chr3S:11153413..11153432 16/20 unknown
chr5L:69730620..69730639 16/20 unknown
chr6S:52298965..52298984 16/20 unknown
chr7L:48430945..48430964 16/20 unknown
chr8L:63800324..63800343 16/20 unknown
tropicalis 10.0 Chr2:55776368..55776387 20/20 Antisense target kdm6a
Chr6:99186322..99186341 17/20 Antisense off-target znf516
Chr8:34306789..34306808 17/20 Antisense off-target pappa
Chr8:34306789..34306808 17/20 Sense off-target LOC116406671
Chr10:21547192..21547211 16/20 Antisense off-target aoc3
Chr6:73342466..73342485 16/20 Sense off-target tmem245
Chr7:64180942..64180961 16/20 Antisense off-target pex14
Chr9:44800744..44800763 16/20 Antisense off-target pgap1
Chr1:115270873..115270892 18/20 unknown
Chr5:68117036..68117055 18/20 unknown
Chr2:75226187..75226206 16/20 unknown
Chr4:125037846..125037865 16/20 unknown
Chr7:32311710..32311729 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers