Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659127

gRNA Name: fbxw7 gRNA1
Synonyms:
Genomic Target: fbxw7

PAM Sequence: GGG
Sequence: 5' AGTGTCTGAGAACACTTGTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 18/20
genomic

gRNA
5' AACAAGTGTTCTCAGACACT 3' |||||||||||||||||||| 3' TTGTTCACAAGAGTCTGTGA 5' 5' GACAAGTGTTCTTAGACACT 3' ||||||||||| ||||||| 3' TTGTTCACAAGAGTCTGTGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:48664207..48664226 18/20 Sense target fbxw7.L
chr1S:44336950..44336969 19/20 Sense off-target LOC108706660 [provisional:fbxw7]
chr4L:124577578..124577597 18/20 Sense off-target grm7.L
chr6S:68553191..68553210 17/20 Antisense off-target drosha.S
chr9_10S:68805106..68805125 17/20 Antisense off-target LOC108703039 [provisional:erbb4]
chr4S:53392903..53392922 16/20 Sense off-target adgrl2.S
chr9_10S:1806441..1806460 16/20 Sense off-target ikzf3.S
chr9_10S:1806441..1806460 16/20 Sense off-target LOC108702488
chr6L:46683717..46683736 18/20 unknown
chr1S:66022662..66022681 16/20 unknown
chr2L:58407785..58407804 16/20 unknown
chr6L:88452770..88452789 16/20 unknown
tropicalis 10.0 Chr1:55548634..55548653 20/20 Sense target fbxw7
Chr2:149456711..149456730 18/20 Antisense off-target LOC108645818
Chr4:90418780..90418799 17/20 Sense off-target LOC100492579
Chr7:51557877..51557896 17/20 unknown
Chr1:121957977..121957996 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers