Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659128

gRNA Name: pten gRNA1
Synonyms:
Genomic Target: pten

PAM Sequence: AGG
Sequence: 5' GAGTTACAATTCCCAGCCAA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' TTGGCTGGGAATTGTAACTC 3' |||||||||||||||||||| 3' AACCGACCCTTAACATTGAG 5' 5' TTGGCTGGGAATTGTGACTC 3' ||||||||||||||| |||| 3' AACCGACCCTTAACATTGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr7S:5633980..5633999 19/20 Sense target pten.S
chr1L:162032233..162032252 16/20 Antisense off-target gin1.L
chr2S:83887492..83887511 16/20 Antisense off-target atp2a3.S
chr9_10S:36918761..36918780 16/20 Sense off-target LOC108702845 [provisional:tbcd]
chr8S:2437933..2437952 19/20 unknown
chr7S:1046607..1046626 16/20 unknown
chr8L:52619959..52619978 16/20 unknown
tropicalis 10.0 Chr7:12950899..12950918 20/20 Sense target pten
Chr2:12078692..12078711 18/20 Antisense off-target erg
Chr8:24951066..24951085 18/20 Antisense off-target LOC108645248
Chr8:31383378..31383397 18/20 Antisense off-target LOC108645184
Chr10:30763645..30763664 17/20 Antisense off-target LOC108644523
Chr3:12974974..12974993 17/20 Sense off-target nmur2
Chr5:17228233..17228252 17/20 Sense off-target haao
Chr9:83535720..83535739 17/20 Sense off-target racgap1.2
Chr1:77867669..77867688 16/20 Antisense off-target ccser1
Chr8:71665344..71665363 16/20 Sense off-target gabbr1
Chr9:73410006..73410025 16/20 Antisense off-target tanc1
Chr10:14569389..14569408 20/20 unknown
Chr8:17392675..17392694 18/20 unknown
Chr3:43204382..43204401 17/20 unknown
Chr8:135702276..135702295 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers