Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659129

gRNA Name: nf1 gRNA1
Synonyms: nf1_g1
Genomic Target: nf1

PAM Sequence: CGG
Sequence: 5' TGTAGAAATACGGCTGAAGA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' TCTTCAGCCGTATTTCTACA 3' |||||||||||||||||||| 3' AGAAGTCGGCATAAAGATGT 5' 5' TCTTTAGCCGTATTTCTACA 3' |||| ||||||||||||||| 3' AGAAGTCGGCATAAAGATGT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:87149357..87149376 19/20 Antisense target nf1.S
Scaffold20:3436881..3436900 18/20 unknown
chr1L:60524035..60524054 16/20 unknown
tropicalis 10.0 Chr2:104771087..104771106 20/20 Antisense target nf1
Chr4:134207300..134207319 17/20 Antisense off-target plxna1
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers