Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659130

gRNA Name: nf1 gRNA2
Synonyms: nf1_g2
Genomic Target: nf1

PAM Sequence: CGG
Sequence: 5' CGAAGCAGACATTCGGAGTT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' AACTCCGAATGTCTGCTTCG 3' |||||||||||||||||||| 3' TTGAGGCTTACAGACGAAGC 5' 5' AACTCCGAATGTCTGCTTCG 3' |||||||||||||||||||| 3' TTGAGGCTTACAGACGAAGC 5' 5' AACTCCGAATGTCTGCTTCG 3' |||||||||||||||||||| 3' TTGAGGCTTACAGACGAAGC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:102874624..102874643 20/20 Antisense target nf1.L
chr2S:87149417..87149436 20/20 Antisense target nf1.S
chr4S:41727175..41727194 17/20 Antisense off-target sntb2.S
chr1L:26998755..26998774 19/20 unknown
chr8S:13473851..13473870 18/20 unknown
chr7L:4037064..4037083 17/20 unknown
tropicalis 10.0 Chr2:104771147..104771166 20/20 Antisense target nf1
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers