Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659131

gRNA Name: notch1 gRNA1
Synonyms:
Genomic Target: notch1

PAM Sequence: CGG
Sequence: 5' GACGGACCTGCAACAAATGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genomic

gRNA
5' ACATTTGTTGCAGGTCCGTC 3' |||||||||||||||||||| 3' TGTAAACAACGTCCAGGCAG 5' 5' ACATCTGTTGCAGGTCCGTC 3' |||| ||||||||||||||| 3' TGTAAACAACGTCCAGGCAG 5' 5' ACATTTGCTGCAGGTCCGTC 3' ||||||| |||||||||||| 3' TGTAAACAACGTCCAGGCAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:4171822..4171841 19/20 Sense target notch1.L
chr8S:29100763..29100782 19/20 Sense target notch1.S
chr2L:146470602..146470621 19/20 Sense off-target endou.L
chr7S:27370778..27370797 17/20 Sense off-target LOC108697472 [provisional:zmat4]
chr5S:130362784..130362803 17/20 unknown
chr6L:16882287..16882306 17/20 unknown
chr1S:6438405..6438424 16/20 unknown
chr3S:119576941..119576960 16/20 unknown
chr3S:74879602..74879621 16/20 unknown
tropicalis 10.0 Chr8:6561840..6561859 20/20 Sense target notch1
Chr5:7827170..7827189 17/20 Antisense off-target itpkb
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers