Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659132

gRNA Name: stag2 gRNA1
Synonyms: stag2_g1
Genomic Target: stag2

PAM Sequence: GGG
Sequence: 5' GATCCACTTAATGGAGAAGA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' TCTTCTCCATTAAGTGGATC 3' |||||||||||||||||||| 3' AGAAGAGGTAATTCACCTAG 5' 5' TCTTCTCCATTAAGTGGATC 3' |||||||||||||||||||| 3' AGAAGAGGTAATTCACCTAG 5' 5' TCTTCTCCATTAAGTGGATC 3' |||||||||||||||||||| 3' AGAAGAGGTAATTCACCTAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:26953497..26953516 20/20 Sense target stag2.L
chr8S:52117235..52117254 20/20 Sense target stag2.S
chr3L:77349477..77349496 18/20 Sense off-target ube2h.L
chr8S:63023116..63023135 18/20 Antisense off-target fmr1.S
chr1S:169282655..169282674 17/20 Sense off-target ccbe1.S
chr5S:87145820..87145839 17/20 Sense off-target LOC108718075 [provisional:dlg1]
chr9_10L:106370613..106370632 17/20 Sense off-target LOC108701637 [provisional:coro7]
chr1S:8016778..8016797 16/20 Sense off-target LOC108706501 [provisional:ctnna2]
chr3L:143936369..143936388 16/20 Sense off-target cldn7.L
chr5L:109390580..109390599 16/20 Antisense off-target LOC108717023 [provisional:trpv5]
chr9_10S:55845690..55845709 16/20 Sense off-target baz2b.S
chr8L:103347766..103347785 18/20 unknown
chr9_10L:115293205..115293224 18/20 unknown
chr1L:205414416..205414435 17/20 unknown
chr4S:51981094..51981113 17/20 unknown
chr1L:78411066..78411085 16/20 unknown
chr1S:21353407..21353426 16/20 unknown
tropicalis 10.0 Chr8:48973720..48973739 20/20 Sense target stag2
Chr3:87011605..87011624 18/20 Sense off-target ube2h
Chr4:125219436..125219455 18/20 Sense off-target bsn
Chr1:201115356..201115375 17/20 Sense off-target ccbe1
Chr10:48757060..48757079 16/20 Sense off-target hs3st3a1
Chr8:118366275..118366294 18/20 unknown
Chr2:103467665..103467684 17/20 unknown
Chr6:32609723..32609742 17/20 unknown
Chr7:96356269..96356288 17/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers