Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659133

gRNA Name: stag2 gRNA2
Synonyms: stag2_g2
Genomic Target: stag2

PAM Sequence: TGG
Sequence: 5' TGGGGACCTGCCATTGTAAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' CTTACAATGGCAGGTCCCCA 3' |||||||||||||||||||| 3' GAATGTTACCGTCCAGGGGT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8S:55863755..55863774 18/20 Sense off-target las1l.S
chr7L:68112941..68112960 17/20 Antisense off-target fez1.L
chr1S:64006672..64006691 16/20 Antisense off-target Xelaev18009447m
chr2L:156135206..156135225 16/20 Sense off-target stard13.L
chr2S:136012140..136012159 16/20 Sense off-target stard13.S
chr8L:23828210..23828229 16/20 Sense off-target las1l.L
chr7L:56271259..56271278 18/20 unknown
chr1L:10785860..10785879 16/20 unknown
chr2S:27582834..27582853 16/20 unknown
chr7L:51029624..51029643 16/20 unknown
tropicalis 10.0 Chr8:48967474..48967493 20/20 Antisense target stag2
Chr1:75941798..75941817 18/20 Sense off-target unc5c
Chr8:33178448..33178467 17/20 Antisense off-target brinp1
Chr8:33181126..33181145 17/20 Sense off-target brinp1
Chr2:152972444..152972463 16/20 Sense off-target stard13
Chr2:131129185..131129204 18/20 unknown
Chr4:140106820..140106839 18/20 unknown
Chr1:143182982..143183001 17/20 unknown
Chr8:32639095..32639114 17/20 unknown
Chr8:32639588..32639607 17/20 unknown
Chr8:32708614..32708633 17/20 unknown
Chr8:32709107..32709126 17/20 unknown
Chr1:23585730..23585749 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers