Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659134

gRNA Name: amer3 gRNA1
Synonyms:
Genomic Target: amer3

PAM Sequence: GGG
Sequence: 5' GTCAGGGACATTTCAAGGTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genomic

gRNA
5' CACCTTGAAATGTCCCTGAC 3' |||||||||||||||||||| 3' GTGGAACTTTACAGGGACTG 5' 5' CACCTTGAAATGTCCCAGAC 3' |||||||||||||||| ||| 3' GTGGAACTTTACAGGGACTG 5' 5' CACCTTGAAATGTCCCAGAC 3' |||||||||||||||| ||| 3' GTGGAACTTTACAGGGACTG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:125445867..125445886 19/20 Sense target amer3.L
chr5S:107736834..107736853 19/20 Sense target amer3.S
chr9_10L:8103633..8103652 18/20 Sense off-target fitm2.L
Scaffold39:508912..508931 17/20 Antisense off-target iqsec3.L
chr6S:91714514..91714533 17/20 Antisense off-target atp6v1h.S
Scaffold26:3246561..3246580 16/20 Antisense off-target LOC108704104 [provisional:ptpn13]
chr1L:80223461..80223480 16/20 Antisense off-target ptpn13.L
chr6S:30429216..30429235 18/20 unknown
chr8S:21775973..21775992 18/20 unknown
chr6S:69587054..69587073 17/20 unknown
Scaffold518:7218..7237 16/20 unknown
chr5L:97309426..97309445 16/20 unknown
tropicalis 10.0 Chr5:126986653..126986672 20/20 Sense target amer3
Chr2:154076248..154076267 18/20 Sense off-target medag
Chr2:154076248..154076267 18/20 Antisense off-target LOC105946588
Chr9:52586818..52586837 16/20 Antisense off-target nbeal1
Chr6:26223466..26223485 18/20 unknown
Chr6:93718957..93718976 17/20 unknown
Chr2:99879091..99879110 16/20 unknown
Chr7:41878363..41878382 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers