Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659135

gRNA Name: celsr2 gRNA1
Synonyms: celsr2_g1
Genomic Target: celsr2

PAM Sequence: TGG
Sequence: 5' GTGGCTGTAATTCTGGCCAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

gRNA
5' CTGGCCAGAATTACAGCCAC 3' |||||||||||||||||||| 3' GACCGGTCTTAATGTCGGTG 5' 5' CTGGCCAGAATTACAGCCAC 3' |||||||||||||||||||| 3' GACCGGTCTTAATGTCGGTG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:67828313..67828332 20/20 Antisense target celsr2.L
chr3L:68520175..68520194 17/20 Antisense off-target slc26a5.L
chr6S:38371566..38371585 16/20 Sense off-target thrb.S
chr5S:109023420..109023439 18/20 unknown
chr2S:49954320..49954339 16/20 unknown
tropicalis 10.0 Chr2:63373489..63373508 20/20 Antisense target celsr2
Chr7:102363479..102363498 17/20 unknown
Chr8:86684606..86684625 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers