Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659136

gRNA Name: celsr2 gRNA2
Synonyms: celsr2_g2
Genomic Target: celsr2

PAM Sequence: TGG
Sequence: 5' GAGACCAGAGTCACGATCAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

gRNA
5' CTGATCGTGACTCTGGTCTC 3' |||||||||||||||||||| 3' GACTAGCACTGAGACCAGAG 5' 5' CTGATCGTGACTCTGGTCTC 3' |||||||||||||||||||| 3' GACTAGCACTGAGACCAGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:67828011..67828030 20/20 Antisense target celsr2.L
tropicalis 10.0 Chr2:63373791..63373810 20/20 Antisense target celsr2
Chr2:71856966..71856985 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers