Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659138

gRNA Name: dnm2 gRNA2
Synonyms: dnm2_g2
Genomic Target: dnm2

PAM Sequence: AGG
Sequence: 5' CAGCTATCTGAGGCAAGTCG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CGACTTGCCTCAGATAGCTG 3' |||||||||||||||||||| 3' GCTGAACGGAGTCTATCGAC 5' 5' CGACTTGCCTCAGATAGCCG 3' |||||||||||||||||| | 3' GCTGAACGGAGTCTATCGAC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:132041723..132041742 19/20 Antisense target dnm2.L
Scaffold20:393030..393049 19/20 Antisense off-target LOC108703474 [provisional:dnm2]
chr1S:52491111..52491130 17/20 Sense off-target larp1b.S
chr2L:92655071..92655090 17/20 Antisense off-target LOC108708302
chr8L:4806932..4806951 17/20 unknown
chr2L:62357083..62357102 16/20 unknown
chr4L:60346371..60346390 16/20 unknown
tropicalis 10.0 Chr3:138759512..138759531 20/20 Antisense target dnm2
Chr8:7336213..7336232 17/20 Sense off-target olfm1
Chr5:84456970..84456989 18/20 unknown
Chr3:35391522..35391541 17/20 unknown
Chr5:147984398..147984417 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers