Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659139

gRNA Name: itsn1 gRNA1
Synonyms: itsn1_g1
Genomic Target: itsn1

PAM Sequence: AGG
Sequence: 5' GCAGGAACTTGCGTGGGCCC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 19/20
genomic

gRNA
5' GGGCCCACGCAAGTTCCTGC 3' |||||||||||||||||||| 3' CCCGGGTGCGTTCAAGGACG 5' 5' GGGCCCACGCAAGTTCCTGC 3' |||||||||||||||||||| 3' CCCGGGTGCGTTCAAGGACG 5' 5' GGGCCCACGCAAGTTCCTAC 3' |||||||||||||||||| | 3' CCCGGGTGCGTTCAAGGACG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:13496427..13496446 20/20 Antisense target itsn1.L
chr2S:20208579..20208598 19/20 Antisense target itsn1.S
Scaffold27:2415078..2415097 16/20 Sense off-target mmd.S
chr3L:59736279..59736298 16/20 unknown
tropicalis 10.0 Chr2:14218325..14218344 20/20 Antisense target itsn1
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers