Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659141

gRNA Name: nog gRNA1
Synonyms:
Genomic Target: nog

PAM Sequence: AGG
Sequence: 5' GGAGGAGAGACTTGGAGTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CCACTCCAAGTCTCTCCTCC 3' |||||||||||||||||||| 3' GGTGAGGTTCAGAGAGGAGG 5' 5' CCACTCCAAGTCTCTCCTCT 3' ||||||||||||||||||| 3' GGTGAGGTTCAGAGAGGAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:27176019..27176038 19/20 Sense target nog.L
chr9_10S:43702169..43702188 16/20 Sense off-target Xelaev18046953m
Scaffold71115:61..80 19/20 unknown
chr1S:103882137..103882156 17/20 unknown
chr9_10L:103053138..103053157 17/20 unknown
chr4S:17583197..17583216 16/20 unknown
chr9_10L:42401966..42401985 16/20 unknown
tropicalis 10.0 Chr10:25898904..25898923 20/20 Sense target nog
Chr2:147329874..147329893 18/20 Sense off-target rarg
Chr5:23873284..23873303 17/20 Antisense off-target c2orf73
Chr8:147092862..147092881 17/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers