Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659142

gRNA Name: rab3gap2 gRNA1
Synonyms: rab3gap2_g1
Genomic Target: rab3gap2

PAM Sequence: TGG
Sequence: 5' GTGGAGCGGCTCTCTGACTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' CAGTCAGAGAGCCGCTCCAC 3' |||||||||||||||||||| 3' GTCAGTCTCTCGGCGAGGTG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:173799107..173799126 18/20 unknown
Scaffold78857:202..221 16/20 unknown
tropicalis 10.0 Chr5:10573499..10573518 20/20 Sense target rab3gap2
Chr5:10573499..10573518 20/20 Antisense off-target iars2
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers