Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659143

gRNA Name: rab3gap2 gRNA2
Synonyms: rab3gap2_g2
Genomic Target: rab3gap2

PAM Sequence: CGG
Sequence: 5' CAGTATGAAGTTGTGTGGAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' CTCCACACAACTTCATACTG 3' |||||||||||||||||||| 3' GAGGTGTGTTGAAGTATGAC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:22635775..22635794 18/20 Antisense off-target LOC108698340 [provisional:pkn2]
chr1L:4422200..4422219 17/20 Sense off-target LOC108697165
chr2S:72652333..72652352 17/20 Sense off-target LOC108709590 [provisional:csmd2]
chr4L:125268482..125268501 17/20 Antisense off-target ssuh2.L
Scaffold40119:162..181 18/20 unknown
chr1S:42385111..42385130 18/20 unknown
chr4S:72685409..72685428 18/20 unknown
chr5S:63822541..63822560 18/20 unknown
Scaffold19:5638355..5638374 17/20 unknown
chr1S:5301447..5301466 17/20 unknown
chr2L:119517207..119517226 17/20 unknown
chr2S:100306419..100306438 16/20 unknown
chr3S:115943020..115943039 16/20 unknown
tropicalis 10.0 Chr5:10573485..10573504 20/20 Sense target rab3gap2
Chr5:10573485..10573504 20/20 Antisense off-target iars2
Chr7:51644770..51644789 17/20 Antisense off-target nrg3
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers