Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659144

gRNA Name: rab11a gRNA1
Synonyms:
Genomic Target: rab11a

PAM Sequence: CGG
Sequence: 5' GAGATTACTCTTCCCCACACCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23 23/23
genomic

gRNA
5' CCGGTGTGGGGAAGAGTAATCTC 3' ||||||||||||||||||||||| 3' GGCCACACCCCTTCTCATTAGAG 5' 5' CCGGCGTTGGGAAGAGTAATCTC 3' |||| || ||||||||||||||| 3' GGCCACACCCCTTCTCATTAGAG 5' 5' CCGGTGTGGGGAAGAGTAATCTC 3' ||||||||||||||||||||||| 3' GGCCACACCCCTTCTCATTAGAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3S:36196353..36196375 23/23 Antisense target rab11a.S
chr3L:107931263..107931285 21/23 Antisense target rab11a.L
tropicalis 10.0 Chr3:116833346..116833368 23/23 Antisense target rab11a
Chr1:19214998..19215020 19/23 unknown
Publications
First: Endosome-Mediated Epithelial Remodeling Downstream of Hedgehog-Gli Is Required for Tracheoesophageal Separation., Dev Cell 2019                    
Most recent:
View All Papers