Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659145

gRNA Name: smad6 gRNA1
Synonyms: smad6_g1
Genomic Target: smad6

PAM Sequence: AGG
Sequence: 5' GAATCTGGAAAACCGGAGTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 18/20 19/20
genomic

gRNA
5' CACTCCGGTTTTCCAGATTC 3' |||||||||||||||||||| 3' GTGAGGCCAAAAGGTCTAAG 5' 5' CGCTCCGGTTTTCCAGATTG 3' | ||||||||||||||||| 3' GTGAGGCCAAAAGGTCTAAG 5' 5' CACTCCGGTTTTCCAGATTG 3' ||||||||||||||||||| 3' GTGAGGCCAAAAGGTCTAAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3S:35721634..35721653 19/20 Sense target smad6.S
chr3L:108458297..108458316 18/20 Sense target smad6.L
chr5L:35503969..35503988 17/20 Antisense off-target LOC108716608
chr1S:148037591..148037610 17/20 unknown
chr3L:111262381..111262400 17/20 unknown
chr3S:114863444..114863463 17/20 unknown
chr6L:121937257..121937276 16/20 unknown
tropicalis 10.0 Chr3:117294525..117294544 20/20 Sense target smad6
Chr10:42719203..42719222 17/20 Antisense off-target LOC101734097
Chr3:140104489..140104508 17/20 Antisense off-target plppr2
Chr3:140104489..140104508 17/20 Sense off-target tmem205
Chr2:168018964..168018983 16/20 unknown
Chr3:55616503..55616522 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers