Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659146

gRNA Name: smad6 gRNA2
Synonyms: smad6_g2
Genomic Target: smad6

PAM Sequence: AGG
Sequence: 5' GCGGCAGGCAGGTGCATCTA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' TAGATGCACCTGCCTGCCGC 3' |||||||||||||||||||| 3' ATCTACGTGGACGGACGGCG 5' 5' TAGATGCACCTGCCTGCCGC 3' |||||||||||||||||||| 3' ATCTACGTGGACGGACGGCG 5' 5' TAGATGCACCTGCCTGCCGC 3' |||||||||||||||||||| 3' ATCTACGTGGACGGACGGCG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:108458434..108458453 20/20 Antisense target smad6.L
chr3S:35721497..35721516 20/20 Antisense target smad6.S
chr8L:113265171..113265190 18/20 Antisense off-target pea15.L
chr1L:75637238..75637257 17/20 Sense off-target slc4a4.L
chr4L:128690069..128690088 16/20 Sense off-target plxna1.L
chr4S:47240760..47240779 18/20 unknown
chr2S:49492619..49492638 16/20 unknown
chr7S:45567541..45567560 16/20 unknown
chr9_10S:43297972..43297991 16/20 unknown
tropicalis 10.0 Chr3:117294662..117294681 20/20 Antisense target smad6
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers