Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659147

gRNA Name: sox2 gRNA1
Synonyms:
Genomic Target: sox2

PAM Sequence: AGG
Sequence: 5' TGGTATGGTCCAGGGGCCAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

gRNA
5' CTGGCCCCTGGACCATACCA 3' |||||||||||||||||||| 3' GACCGGGGACCTGGTATGGT 5' 5' CTGGCCCCTGGACCATACCA 3' |||||||||||||||||||| 3' GACCGGGGACCTGGTATGGT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold33547:574..593 20/20 Sense target sox2.L
chr2L:115362207..115362226 19/20 Sense off-target sox1.L
chr3L:39088585..39088604 17/20 unknown
tropicalis 10.0 Chr5:108037294..108037313 20/20 Sense target sox2
Chr3:109502565..109502584 16/20 Sense off-target LOC116409779
Chr3:51927364..51927383 16/20 Antisense off-target avpr1a
Chr4:147508789..147508808 19/20 unknown
Chr7:37741897..37741916 17/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers