Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659148

gRNA Name: tyr gRNA1
Synonyms: tyr_g1
Genomic Target: tyr

PAM Sequence: CGG
Sequence: 5' GAAATCCTGGTGGCCACGAT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 18/20
genomic

gRNA
5' ATCGTGGCCACCAGGATTTC 3' |||||||||||||||||||| 3' TAGCACCGGTGGTCCTAAAG 5' 5' GTCGTGGCCACCAGGGTTTC 3' |||||||||||||| |||| 3' TAGCACCGGTGGTCCTAAAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold90756:82..101 18/20 Sense target tyr.L
chr3L:127684808..127684827 17/20 Sense off-target ddx39a.L
chr7L:92560566..92560585 17/20 Antisense off-target kcnab2.L
Scaffold2689:182..201 18/20 unknown
chr2S:965022..965041 17/20 unknown
chr9_10S:17443168..17443187 17/20 unknown
chr2S:69434..69453 16/20 unknown
chr9_10S:64327444..64327463 16/20 unknown
tropicalis 10.0 Chr2:167825693..167825712 20/20 Sense target tyr
Chr2:144704347..144704366 18/20 Antisense off-target pde1b
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers