Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659149

gRNA Name: tyr gRNA2
Synonyms: tyr_g2
Genomic Target: tyr

PAM Sequence: GGG
Sequence: 5' AGCTGTTGTAGGCAATCGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' CCCGATTGCCTACAACAGCT 3' |||||||||||||||||||| 3' GGGCTAACGGATGTTGTCGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:21534817..21534836 16/20 unknown
chr8S:17928724..17928743 16/20 unknown
tropicalis 10.0 Chr2:167825660..167825679 20/20 Antisense target tyr
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers