Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659150

gRNA Name: tyr gRNA3
Synonyms: tyr_g3
Genomic Target: tyr

PAM Sequence: CGG
Sequence: 5' AGGATCCTATGCAATGGTAC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' GTACCATTGCATAGGATCCT 3' |||||||||||||||||||| 3' CATGGTAACGTATCCTAGGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:28285694..28285713 18/20 Sense off-target engase.L
chr5S:74058241..74058260 17/20 unknown
tropicalis 10.0 Chr2:167825733..167825752 20/20 Sense target tyr
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers