Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659152

gRNA Name: tyr gRNA5
Synonyms: tyr_g5
Genomic Target: tyr

PAM Sequence: TGG
Sequence: 5' GGTGTTCCTGAAGCTAAAGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 18/20 19/20
genomic

gRNA
5' ACTTTAGCTTCAGGAACACC 3' |||||||||||||||||||| 3' TGAAATCGAAGTCCTTGTGG 5' 5' ACTTCAGCTTCAGGAACACA 3' |||| |||||||||||||| 3' TGAAATCGAAGTCCTTGTGG 5' 5' ACTTTAGCTTCAGGAACACG 3' ||||||||||||||||||| 3' TGAAATCGAAGTCCTTGTGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:149896792..149896811 19/20 Antisense target tyr.S
Scaffold90756:196..215 18/20 Antisense target tyr.L
Scaffold43:1575155..1575174 17/20 Antisense off-target zbtb8b.S
chr6L:93968849..93968868 17/20 Sense off-target LOC108719153
chr7S:15190991..15191010 17/20 Sense off-target adam12.S
chr9_10S:38207059..38207078 17/20 Sense off-target stx8.S
chr5L:101839898..101839917 16/20 Sense off-target mcf2l.2.L
chr6L:26573188..26573207 16/20 Sense off-target rundc3b.L
Scaffold2689:296..315 18/20 unknown
Scaffold17742:260..279 17/20 unknown
chr1L:123076120..123076139 17/20 unknown
chr8S:24245317..24245336 17/20 unknown
chr9_10L:41752486..41752505 17/20 unknown
chr6L:31400144..31400163 16/20 unknown
chr6S:100975047..100975066 16/20 unknown
tropicalis 10.0 Chr2:167825579..167825598 20/20 Antisense target tyr
Chr1:162911190..162911209 18/20 Antisense off-target hvcn1
Chr1:127432193..127432212 18/20 unknown
Chr4:63066914..63066933 18/20 unknown
Chr6:71704020..71704039 17/20 unknown
Chr1:97820012..97820031 16/20 unknown
Chr6:42788021..42788040 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers