Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659153

gRNA Name: tyr gRNA6
Synonyms: tyr_g6
Genomic Target: tyr

PAM Sequence: TGG
Sequence: 5' GGGCCCCTGTTCAGAAATCC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' GGATTTCTGAACAGGGGCCC 3' |||||||||||||||||||| 3' CCTAAAGACTTGTCCCCGGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:11895961..11895980 18/20 Antisense off-target hlcs.L
chr5L:138585977..138585996 16/20 unknown
tropicalis 10.0 Chr2:167825706..167825725 20/20 Sense target tyr
Chr1:25055240..25055259 18/20 Antisense off-target sorcs2
Chr2:155781697..155781716 18/20 Antisense off-target cdk8
Chr8:5327521..5327540 17/20 Antisense off-target fam163b
Chr1:33173470..33173489 17/20 unknown
Chr5:137651062..137651081 17/20 unknown
Chr7:73492546..73492565 17/20 unknown
Chr6:10405371..10405390 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers