Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659154

gRNA Name: prph2 gRNA1
Synonyms: prph2_L
Genomic Target: prph2

PAM Sequence: AGG
Sequence: 5' AGGAGAGTGAAACTGGCCCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 20/20 19/20
genomic

gRNA
5' TGGGCTAGTTTCACTCTCCT 3' ||||| |||||||||||||| 3' ACCCGGTCAAAGTGAGAGGA 5' 5' TGGGCCAGTTTCACTCTCCT 3' |||||||||||||||||||| 3' ACCCGGTCAAAGTGAGAGGA 5' 5' TGGGCAAGTTTCACTCTCCT 3' ||||| |||||||||||||| 3' ACCCGGTCAAAGTGAGAGGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:10326326..10326345 20/20 Sense target prph2.L
chr5S:17976492..17976511 19/20 Sense target prph2.S
chr8L:118483902..118483921 18/20 Sense off-target cgn.L
chr1S:7742171..7742190 17/20 Sense off-target LOC108706501 [provisional:ctnna2]
chr4L:46486260..46486279 18/20 unknown
chr5L:42524319..42524338 18/20 unknown
chr1S:146815000..146815019 17/20 unknown
chr2S:106112816..106112835 17/20 unknown
chr3L:17575444..17575463 17/20 unknown
chr3S:81682549..81682568 17/20 unknown
chr3S:94523901..94523920 17/20 unknown
chr5S:121034449..121034468 17/20 unknown
chr7S:23190053..23190072 17/20 unknown
chr8L:76001854..76001873 17/20 unknown
chr9_10L:86786534..86786553 17/20 unknown
Scaffold29:2941340..2941359 16/20 unknown
chr2L:21371667..21371686 16/20 unknown
tropicalis 10.0 Chr5:15258363..15258382 19/20 Sense target prph2
Chr2:149194998..149195017 17/20 Antisense off-target setdb2
Chr4:102403774..102403793 17/20 Antisense off-target dpyd
Chr4:30525759..30525778 17/20 Sense off-target muc2
Chr8:110959169..110959188 18/20 unknown
Chr1:171292668..171292687 17/20 unknown
Chr1:29528207..29528226 17/20 unknown
Chr1:96816021..96816040 17/20 unknown
Chr3:110611648..110611667 17/20 unknown
Chr7:103092751..103092770 17/20 unknown
Chr7:87440931..87440950 17/20 unknown
Chr8:69361840..69361859 17/20 unknown
Chr5:83894668..83894687 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers