Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659155

gRNA Name: fxr1 gRNA1
Synonyms: fxr1_L
Genomic Target: fxr1

PAM Sequence: CGG
Sequence: 5' GACATGACGGTGGAAGTGCG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

gRNA
5' CGCACTTCCACCGTCATGTC 3' |||||||||||||||||||| 3' GCGTGAAGGTGGCAGTACAG 5' 5' CGCACTTCCACCGTCAGGTC 3' |||||||||||||||| ||| 3' GCGTGAAGGTGGCAGTACAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:104579371..104579390 20/20 Sense target fxr1.L
chr5S:89214552..89214571 19/20 Sense target fxr1.S
Scaffold21:3359431..3359450 18/20 unknown
chr2L:152911752..152911771 18/20 unknown
chr2S:61220977..61220996 18/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers