Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659156

gRNA Name: prickle1 gRNA1
Synonyms: prickle_L
Genomic Target: prickle1

PAM Sequence: AGG
Sequence: 5' TGCGGAGAGAAGATTAATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' CCATTAATCTTCTCTCCGCA 3' |||||||||||||||||||| 3' GGTAATTAGAAGAGAGGCGT 5' 5' CCATTAATCTTCTCTCCGCA 3' |||||||||||||||||||| 3' GGTAATTAGAAGAGAGGCGT 5' 5' CCATTAATCTTCTCTCCGCA 3' |||||||||||||||||||| 3' GGTAATTAGAAGAGAGGCGT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:56107866..56107885 20/20 Sense target prickle1.L
chr3S:82057807..82057826 20/20 Sense target prickle1.S
chr1L:168915746..168915765 18/20 Sense off-target slc12a2.L
chr1S:74604089..74604108 18/20 Antisense off-target Xelaev18009583m
chr1S:74604089..74604108 18/20 Sense off-target adgrl3.S
chr5L:16614957..16614976 18/20 Antisense off-target wdr26.L
chr5S:12672231..12672250 17/20 Antisense off-target wdr26.S
chr8S:40916324..40916343 16/20 Sense off-target psmb7.S
chr3L:107481401..107481420 19/20 unknown
chr3S:69765759..69765778 17/20 unknown
tropicalis 10.0 Chr3:64772903..64772922 20/20 Sense target prickle1
Chr4:119570355..119570374 18/20 Antisense off-target pla2g4a
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers