Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659157

gRNA Name: slc16a2 gRNA1
Synonyms: slc16a2_L
Genomic Target: slc16a2

PAM Sequence: AGG
Sequence: 5' AGGGGTCGGGTGCCCGACGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

gRNA
5' CCGTCGGGCACCCGACCCCT 3' |||||||||||||||||||| 3' GGCAGCCCGTGGGCTGGGGA 5' 5' CCGTCGGGCACCCGACCCCT 3' |||||||||||||||||||| 3' GGCAGCCCGTGGGCTGGGGA 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:25166510..25166529 20/20 Sense target slc16a2.L
chr8S:54421428..54421447 20/20 Sense target slc16a2.S
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers