Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659158

gRNA Name: eya1 gRNA1
Synonyms: eya1_L
Genomic Target: eya1

PAM Sequence: AGG
Sequence: 5' GGACATTTAGACAACTTCTC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' GAGAAGTTGTCTAAATGTCC 3' |||||||||||||||||||| 3' CTCTTCAACAGATTTACAGG 5' 5' GAGAAGTTGTCTAAATGTCC 3' |||||||||||||||||||| 3' CTCTTCAACAGATTTACAGG 5' 5' GAGAAGTTGTCTAAATGTCC 3' |||||||||||||||||||| 3' CTCTTCAACAGATTTACAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold52:253310..253329 20/20 Sense target eya1.L
chr6S:97513547..97513566 20/20 Sense target eya1.S
chr8L:47665415..47665434 17/20 Antisense off-target map7d3.L
chr8L:49076503..49076522 17/20 Antisense off-target fkrp.L
chr7L:122704523..122704542 16/20 Sense off-target LOC108696885
Scaffold19:2861744..2861763 18/20 unknown
chr2S:86839178..86839197 18/20 unknown
chr8L:129326..129345 18/20 unknown
chr8L:47246133..47246152 18/20 unknown
chr6L:107573079..107573098 17/20 unknown
chr2L:21544975..21544994 16/20 unknown
tropicalis 10.0 Chr6:120536282..120536301 20/20 Sense target eya1
Chr7:79169046..79169065 17/20 Antisense off-target trim29
Chr8:70249177..70249196 17/20 Antisense off-target fkrp
Chr5:87299564..87299583 16/20 Antisense off-target syncrip
Chr7:86494560..86494579 16/20 Antisense off-target ttc12
Chr8:72619163..72619182 18/20 unknown
Chr6:58205635..58205654 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers