Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659159

gRNA Name: pkd1 gRNA1
Synonyms: pkd1_L
Genomic Target: pkd1

PAM Sequence: AGG
Sequence: 5' GCATGTTGTTGGGTTACCCG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' CGGGTAACCCAACAACATGC 3' |||||||||||||||||||| 3' GCCCATTGGGTTGTTGTACG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:107993509..107993528 20/20 Sense target pkd1.L
chr7S:31396195..31396214 17/20 Antisense off-target gbf1.S
chr6L:93074159..93074178 16/20 Antisense off-target LOC108718534 [provisional:cdkal1]
chr8S:11802401..11802420 16/20 Sense off-target ppp2r5c.S
chr3L:28659846..28659865 16/20 unknown
chr8S:47319267..47319286 16/20 unknown
tropicalis 10.0 Chr8:63351737..63351756 16/20 Sense off-target LOC100488567
Chr10:46516245..46516264 17/20 unknown
Chr4:16634962..16634981 16/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers