Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659161

gRNA Name: hmgcr gRNA1
Synonyms: hmgcr_L
Genomic Target: hmgcr

PAM Sequence: AGG
Sequence: 5' GCCCGTGGCATGGCAATTCT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 20/20 20/20
genomic

gRNA
5' AAAATTGCCATGCCACGGGC 3' | |||||||||||||||||| 3' TCTTAACGGTACGGTGCCCG 5' 5' AGAATTGCCATGCCACGGGC 3' |||||||||||||||||||| 3' TCTTAACGGTACGGTGCCCG 5' 5' AGAATTGCCATGCCACGGGC 3' |||||||||||||||||||| 3' TCTTAACGGTACGGTGCCCG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:187447098..187447117 20/20 Sense target hmgcr.L
chr1S:156431941..156431960 20/20 Sense target hmgcr.S
chr7S:19313861..19313880 18/20 unknown
tropicalis 10.0 Chr1:184201686..184201705 19/20 Sense target hmgcr
Chr8:60585574..60585593 18/20 Sense off-target pcdh11x
Chr3:103996280..103996299 19/20 unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers