Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659162

gRNA Name: arntl gRNA1
Synonyms: arntl_S
Genomic Target: arntl

PAM Sequence: GGG
Sequence: 5' CGGGACATGGCGTTGCACGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 20/20 20/20
genomic

gRNA
5' ACGTGCAACGCCATGTCGCG 3' ||||||||||||||||| || 3' TGCACGTTGCGGTACAGGGC 5' 5' ACGTGCAACGCCATGTCCCG 3' |||||||||||||||||||| 3' TGCACGTTGCGGTACAGGGC 5' 5' ACGTGCAACGCCATGTCCCG 3' |||||||||||||||||||| 3' TGCACGTTGCGGTACAGGGC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:4688628..4688647 20/20 Antisense target arntl.L
chr4S:18501062..18501081 20/20 Antisense target arntl.S
chr4S:45969944..45969963 18/20 Antisense off-target tshz3.S
tropicalis 10.0 Chr4:6817686..6817705 19/20 Antisense target arntl
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers