Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659184

gRNA Name: tp53 gRNA1
Synonyms:
Genomic Target: tp53

Sequence: 5' CCTCAACTGAGGATTACGCAGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

gRNA
5' CCCTGCGTAATCCTCAGTTGAGG 3' ||||||||||||||||||||||| 3' GGGACGCATTAGGAGTCAACTCC 5' 5' CCCAGCATAATCCTCAGTTGAGG 3' ||| || |||||||||||||||| 3' GGGACGCATTAGGAGTCAACTCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold20:8062057..8062079 21/23 Sense target tp53.S
chr3L:78932121..78932143 19/23 unknown
chr5S:85334921..85334943 19/23 unknown
tropicalis 10.0 Chr3:153636773..153636795 23/23 Sense target tp53
Publications
First: RBL1 (p107) functions as tumor suppressor in glioblastoma and small-cell pancreatic neuroendocrine carcinoma in Xenopus tropicalis., Oncogene 2020            
Most recent:
View All Papers